In Germany, the pandemic emergency has now been declared over by a new law. But instead, the government can now just use all the measures, and more, whenever they want. Not even the parliament needs to approve.
Well, I said I won’t make a habit of it, didn’t I? I am sorry. It won’t happen again? 
Hi Fab,
Starting here a rather long post regarding some comment which was a little off the main topic of episode 96. But it seems to be a repeating issue and I need to start somewhere…
So, in this episode, you repeated the statement that the Nazis “persecuted a Religion”, which sounds a bit dissonant to me.
Like in the case of my previous correction (about “Galileo & Round Earth”), I think that the reason that it irks me is because it reinforces a misconception which is effectively used for the propaganda of certain groups.
However, in this case I believe that your usage of this terminology comes from trying to avoid using the word “race”, which in turn
goes back to to episode 22 (“Stand together not divided”), and some related topics, on which I have comments, but believe that explaining clearly where my views differ from yours would take me a long time. That is why I kept postponing this feedback until now (for me, this kind of writing is not a regular effort, and it takes several iterations to become coherent enough).
I will try to fulfill this debt in upcoming posts or email. But for now I will just focus on clarifying this particular irk, starting with facts that I am sure you (and probably most people in this forum) already know.
First of all, although the Nazi leadership cared a lot about political beliefs, to the best of my knowledge they did not care much about religion (other than as a tool to serve the state).
Certainly the persecution of the Jews and the Roma people did not depend on their religious beliefs.
The persecuted people were identified by external appearance, as taught in race class[1][2]
If you were a Jew by birth, you were an enemy of the state. No belief or statement of loyalty could save you from that - only documents proving the “aryan blood” of your grandparents (well, if you only had one jewish grandparent, then you would be a “Mischling zweiten Grades”, so you could live as a German without getting castrated, provided you followed the restrictions and did not look too jewish).
Saying that the Nazis persecuted a religion reinforces the misconception that the persecution depended on anything that the persecuted people thought, did or believed. This misconception serves the cause of people who want to deny or diminish the holocaust, through the usual “divide and conquer” thinking (“surely that would not happen to me”…).
Sure, persecution due to religion is also a bad thing that should be banned, but it was certainly not the main case in Nazi Germany.
So, I would not try to convince you to use the word “race” in this context (well, not for now, at least 
), but maybe we could settle on something that would sound less “disinformative” to me (I think you ment religion as the suspected original trigger of xenophobia rather than as the target of actual persecution, but I would prefer to just not leave room for such doubts).
Maybe “nationality”? “ethnic group”? “ancestry”? even “culture” is a little better, because it includes things like language, clothing and customs rather than just belief.
Or course, I could just get used to any language you use. I do understand what you were trying to say, and certainly not offended. I only went into these details to ensure that the background is fully understood.
I know this is a special topic for you because of your background. But keeping with my usual style, I will be brutally honest. I hope you understand this is not directed against you personally. 
I might also bring this up on the show, because I think you’re not the only one thinking this way.
You are completely incorrect here and you’re (probably subconsciously) actually buying into Nazi propaganda.
Scientifically speaking, from today’s perspective (which we necessarily use in historical science to evaluate the past), Judaism is a religion. Jews are members of a religion.
Antisemites at the turn of the 20th century tried to establish a (false) scientific belief system that postulated that there are human races. This is wrong and has been thoroughly disproven by biologists since. But these historic antisemites tried to convince people that there are human races and that Jews are in fact not a religious group but an ethnic group and that this ethnic group was a race.
All of this is wrong, but what made the argument convincing is that they conflated an ethnic group (ie. a certain socio-economic class in Europe) that happened to be Jewish with the religion. Which, if you think about it, is utter bullshit because even if I was born back then into a family in Europe that had been Jewish for generations, I could have just converted to Christianity and boom, wouldn’t have been a Jew any more.
And this is where the Nazis (ie. the actual NSDAP and their foremost thinkers) took this idea of race and made it important that Jews actually are a race. Because their goal was to create a mystical enemy of the mystical German people (the Volk, which goes back to the völkisch idea which is as stupid as the race idea). And you can’t do that when your enemy can just change denomination and the they are not your enemy any more. You need to make it about breeding, which also modernised the idea. Because back then with the onset of geneticism (Mendel, Darwin etc.) this kind of thing sounded very plausible and scientifically forward thinking.
So why it was understandable for people to think that way, it’s been debunked six ways from Sunday since then by biologists, medical doctors, historians and sociologists.
So to be perfectly clear here:
Which means that the Nazis did, in fact, discriminate against a religion. From today’s scientific standpoint.
From their standpoint, they discriminated against a race of people. But their standpoint was biologically and sociologically utterly illogical.
By saying that the Nazis were discriminating against a religion, I wasn’t trying to make it sound less bad. I was merely using the proper scientific terminology.
See, my problem with that is that it tries to set Jews apart. Which is actually also my issue with the politics of Israel as a state.
To me, Jews are just people with a common religion. Like Muslims and Christians. In the same way that you get Muslims from Iran and Muslims from Indonesia you get Jews from Israel and Jews from the US – which are very different from each other.
I understand that it helps to distinguish certain cultural traits and values but I’ve never understood why they need to be tied so much to religion. Let’s say I grow up in Israel and decide to be an atheist. That doesn’t take away from my culture and the history of my family, does it? I might not be a Jew, but I’m still a citizen of Israel, member of the diaspora etc. And the Nazis would still have gassed me back in the day.
Not to mention that, historically speaking (ie. before WWII), Jewish culture used to be very different. A huge part of German culture in the Holy Roman Empire and before that used to be that same culture. European culture was Jewish culture. The Nazis destroyed all of that. I just wish we could go back to that instead of continuing their legacy by segregating people based on religion or their history and holding on to the belief that people are oh-so-different when, really, we are all very much the same.
This is only correct for the Ashkenazi Jewish culture - which is different from Sephardic Jews culture (from various Arab countries, which share a lot with Arab culture), but there is still the “Jewish” culture/history/myth, unrelated to the European culture.
Jews are also different from Muslim & Christians, as there is the genetic marker of “Jewish” - seen in the genetic origin services that are popular now. It is from several historical reasons (diaspora, being more insular as community) before the last 100 years. Compare that to Islam & Christianity, that are mostly converted native populations.
But as you said, Nazis didn’t care about it.
What I am trying to say here is that there is no Jewish culture. Just as there is no “Christian culture”. There are cultural similarities, but you’d never get the idea to claim Spanish and Russian cultures are one culture. Or Turkish and Iraqi cultures. The only reason this is done with “Jewish culture” is because of the aforementioned antisemitic viewpoint originating in Europe in the 18th and 19th century. As a reaction, it has been adopted by the other side as well.
Still, this kind of categorisation is purely politic. It could be used for a million other cultural markers, religious and otherwise. The focus is there purely for political reasons.
This makes no sense. Judaism is a religion. Of course different people with that religion developed different traits living in different places and dealing (and becoming part of) different cultures.
What the statement you responded towards was trying to convey was: People with Jewish faith were as much part of the culture of Europe in the Middle Ages as people with Christian (and to a lesser degree) Islamic faith. The idea that Jews are a race and are different from other Europeans in ways that people of other faith (and/or background) are not, is unscientific propaganda. It has influenced a lot of thinking but it is still bullshit.
This, again, is unscientific bullshit. There are no genetic markers for religion, culture or any other historic background.
What you are describing is someone looking at a genetic sequence and associating this with a given cultural background. This can be useful but it can also be complete bullshit.
You need to understand that while you DNA can encode a phenotype like, say, skin colour, it can’t encode where you’re from or what religion you have. You can scientifically say AGGCTTTCGGTTTAAA tells me this person has black skin. DNA works that way. You can’t say GTTTCTTCTTATGGGTATTAAA means this person is Jewish. DNA doesn’t work that way.
You can say “people with GTTTCTTCTTATGGGTATTAAA in their genetic makeup tend to historically be from this part of the world, they are somewhat related” and from that you can infer things. It gets very unsteady ground scientifically very quickly, though.
The reason why stupid websites on the internet tell you things like “that part of your DNA means you are Jewish” is because they are made by people who think races exist and also think being Jewish is a race. This is sadly a very widespread misconception in places like the US (where it seems to even be taught in schools). Of course you can use scientific methods to run a website to analyse people’s DNA and then make (pretty unscientific) classifications like this. But that doesn’t make you right.
Woho, seems like there will be lots more to discuss (maybe even more than I expected…) - I will not keep postponing this discussion, but I will certainly not be able to address enough of it for this week…
On one hand this is certainly more interesting than preaching to the choir, on the other hand, I fear that diving too deep into these topics would divert the focus from the topics for which I started following this podcast, and might not be as interesting to people in your audience that do not live in the specific corner of the globe which I happened to be born into. In particular, Israeli politics is a topic that can fill whole shows (which, of course, it actually does… but I did not come here for more of those, and maybe that’s true for others too). So I am considering continuing by a sequence of long emails (depending of course on the reactions here). I will touch a few of these points later on today - just to give a little clue to where I’m coming from (you seem to have some misconceptions about my viewpoints).
But - first of all - it seems that despite my graphic references, I have utterly failed to explain my main point (which I still believe can be discussed orthogonally from issues like what Judaism actually is, what “racism” means and whether or not non-existant things should be named).
So - I will now make one final attempt. I was trying to distinguish between what you perceive as the reason or trigger or excuse for the persecution and the Nature of the persecution itself.
For the persecuted people, the reasoning of the persecutors did not matter much. What mattered the most is whether or not you could do something to save yourself. Changing your religion would certainly not achieve that. Many of them were already first and second-generation atheists or christians. What could theoretically have a chance would be things like dying your hair, wearing makeup, and forging your family dynasty documents.
Sadly, I think that these are historical facts that are not well known enough (maybe Germany and Israel have better statistics in that sense than other countries, but I do not know). When people who are oblivious to these facts hear that “jews were persecuted for their religion”, they would naturally think that this was something like the 1492 spanish expulsion - only against people who refused to abandon their old faith, and therefore not relevant for e.g. “enlightened scientific atheists” (or whatever other categories they classify themselves as). By having this misconception they become more susceptible to holocaust deniers’ propoganda, and this is what I ment by “divide and conquer”.
This was only my attempt to explain my dissatisfaction with such statements. It is caused by what this wording probably (and incorrectly) imply to people who are not familiar with the facts, and the propogandas that feed on such misconceptions. This, on its own, is independent from what you were actually trying to say, and whether or not I agree with it.
You might not believe that such misconceptions actually exist or that this kind of phrasing could possibly have such effect on uninformed people. I tend to think otherwise, but might agree that in this particular forum this is not a significant risk, so - as I said - if you continue with the same phrasing I would probably just get used to it.
re: later on today I actually ment “here”
As much as it is tempting to address these other points now (seems like a hanging curve ball or two waiting for me there 
), I prefer to postpone them, even for another day, to ensure that the main point above gets its own attention (after all, it was the original purpose of the initial post).
Some feedback regarding vaccine mandates. In general I am somewhat for vaccine mandates perhaps more so at the company level than the government. You need to be vaccinated to work at certain jobs to attend more risky events like concerts without physical distancing etc.
A few comments you made I take issue with.
Yes, that nags at me when Fab draws comparisons to smoking (but not second hand smoke) or riding a motorcycle. I haven’t looked exhaustively at papers for evidence, but there was an Imperial College of London study that seemed okay to me supporting the idea that it’s not purely a personal decision whether you get vaccinated. Not that it made a case whether a vaccine would stop SARS-CoV-2 in the way say the Polio or Smallpox vaccines did for the viruses causing those diseases, but that vaccinated people act less as a conduit for further spread. I have no medical or microbiology background, but it do you need to to suppose there is a plausible mechanism to go with those population survey results, i.e. that you have lower viral load or else have your viral load over a shorter time period if you’re exposed to a virus after vaccination.
[whoops, update: I could have sworn I saw that conclusion in the REACT study a month or two ago, but today I see one of the researchers say they have been unable to conclude anything about vaccine effectiveness at stopping spread due to too small a sample size of unvaccinated: Real-time Assessment of Community Transmission findings | Faculty of Medicine | Imperial College London Uh, maybe I should delete this post, since that invalidates a lot of what I wrote, but I’ll leave it pending a study that actually shows this, if that ends up happening – now I guess we don’t know – not knowing is different from knowing it doesn’t prevent spread, though]
Now, this week I did find a nice article by one of my favorite authors / pundits in support of something Fab argues (IIRC) with about exemptions. I was doubting a little whether all religious exemptions should be permissible. Someone close to me acquired new support for her exemption in this sort of, wrong words, but I’ll say crowd sourced way that Feldman describes in the article. Now, I never liked the way she was pressured to get a vaccine but at the same time I thought her explanation why she shouldn’t was flimsy. But he points out that it can’t be the government’s role to evaluate the quality of a religious exemption claim. If we allow any religious exemptions we must allow all. I see no holes in this argument: Religion and the Covid Vaccine: Honor the Right to Say No - Bloomberg
The only place that argument gets fuzzy for me is if the mandate is entirely done by a private entity, not by a state law or executive order. I’m not so sure the same reasoning applies then.
Ugh this is too long again, but the other part nagging at me is about the probabilities involved. Fab seemed to allow for coercive state action if the disease was infectious and dangerous enough (Ebola). So what order of magnitude risk do the tradeoffs against civil liberties start to look reasonable? Makes me think of the Pearson’s Puppeteer character in Larry Niven’s Ringworld books. It’s been awhile, but I’m remembering it as him (it?) ending up being dangerous to man and Kzin due to his low risk tolerances. It seemed to me Niven was extrapolating risk comfort for an intelligent being descended from herd animals vs. that from primates or felines. Point being, do views on things like mandates come down to our subjective risk tolerances (you know, aside from measures that are just plainly dumb, which there’ve been a few of)?
Re: touching these other points:
Since I see that other posts, which are more on-topic, have appeared on this thread, and I do not want to steal too much bandwidth, I will try to keep it brief, and focus on identifying the things on which we actually disagree rather than try to explain or resolve them. It would still be long - but my last on this thread (unless specifically asked otherwise).
Sure, would not accept any other approach 
But why on earth would I take this personally?
Saying I am wrong is an opinion, not “against” anything, and certainly not offensive, not to me at least.
For the rest: I think I had described myself as being Agnostic before. If not - hi 
.
I might define that term slightly differenetly than you, but I am certainly not religious, so by your definition, if I understand it correctly, I am not jewish. Therefore whatever you say about “jews” is not related to me personally, right?
I might try to respond to some of your arguments elsewhere, but more importantly - it seems to me that some of them might be trying to address non-existing disagreements, so I will start with your summary of conclusions:
I might argue about certain details, but I think we completely agree on the core idea: an ill-defined concept, based on pseudo-science.
My disagreement with some of your statements is on an entirely different dimension - basically I just do not think that it matters much if “race” has any reasonable meaning or not.
Discriminating based on real things may be a little less stupid than discriminating based on nonsense, but just as wrong.
Eye-color has well-identified genes. Is it OK to persecute people based on their eye color?
If there were Neanderthals living among us, or Narns (the B5 alien species), or people whose mind was uploaded into 100% mechanical robots that do not have any DNA, would it be OK to enslave or exterminate them?
I can accept that as your definition for Judaism. But would emphasize two things:
First, this does not follow logically from scientific standpoint as you seem to say: You might claim that “Jews are a race” is not a valid statement (“race” being a fake-science nonsense). But “A is not B” does not prove “A is C”. Especially when “C” is “religion”, which is not a very scientific domain, and not as easy to define in a clear-cut way as people might think.
Second, your definition does not match the definition of many others, including a lot of the people that you would define as jews. For example, religious orthodox jews would not agree with it, and in ways that I believe you do not expect (I say this based on things you had said, and because that particular religious group defines things in significantly different ways than, for example, christianity, which you might be more familiar with. I intend to expand on that in a separate mail, assuming you are interested).
So, when my goal is to be understood correctly (rather then re-educate the listener), I generally try to use definitions that I expect to be the closest match to my audience’s one.
Not much argument there. But I am not sure what you are trying to say…
If something is hard to define, that does not necessarily mean that it does not exist, or that we should not talk about it (similarly, if something did not exist before a certain date - that does not necessarily mean that it does not exist now).
Are you claiming that there is no such thing as a German ethnicity? No such thing as “nations” at all? What about “culture”? In what way (if at all) is “German” different than “French”?
And more specifically, I think that you mentioned that “national states” are a good thing (e.g. in EU context).
How do you define what that term means? How would you best design the borders of such states?
These particular questions I am asking literally, not trying to lead to some conclusion (I am not even sure how I would answer them, but they seem relevant to understanding what you were trying to say above).
Maybe I can make an “Episode 100” question out of that…
Not sure what “it” refers to in this sentence…
In the context of the sentence that you quoted, quite the contrary - I was specifically trying to describe who was persecuted by using a more general characterization than “jews”.
I even specifically mentioned the Romani, who were persecuted in almost identical way as the “jews” were, while certainly not being jewish, even by Nazi definitions (BTW: is there such a thing as “the Gypsy religion”? would you say that they were persecuted for their religion?)
As for Isreali politics, well… This is complicated. As you’d expect, there are opposing parties in major disagreement with each other. Some would classify “jews” as one group out of a given class (either “nations” or “religions”, or both), and some that think that the very idea of jews trying to be comparable with other groups in any way is reprehensible (those would be religious parties… this is probably a common feature of many religions).
Last, but not least:
That is probably the most important thing to discuss, but again I think we are in perfect agreement on the core points, one of which is - that in particular we are all the same in “the thing that morally grants you human rights” which I would call “being human” (and might not be easy to define - see my strange examples above, involving aliens and robots…)
Yes, I understand this. It was also never in question. I understand that the discrimination against Jews in the Third Reich isn’t comparable to discriminating against unvaccinated people today and I never tried to do that. That would not make much sense because you’re comparing an autocratic dictatorship to a democratic republic. The same rules simply do not apply.
That may be the case. But just because this happens to people who are not well educated, you want me to stop using scientifically correct statements? That’s not the way to bring everyone’s education level up. By dumbing the discourse down because we fear misunderstanding, we make it worse, not better.
The problem is that there is no mechanism for this in the law as far as I can see. And if you want to enter a restaurant and the waitress has to check your 3Gs, a letter from a doctor isn’t accepted, as far as I can tell. How would they tell it’s genuine, anyway? They can barely do that with the yellow passports. There’s also no way for the digital certificates to even encode information like that, as far as I know.
So for the indents and purposes of the law in its practical application, there are no exceptions.
This theory is, as far as I can tell, not held up by any evidence in pre-2019 scientific literature.
Also, if this theory is true, how do you explain that the spread of SARS-CoV-2 in Germany is as widespread as ever right now (according to the somewhat-bullshit incident data, but alas that is all we have – thanks RKI!) when the vaccination rate is steadily climbing and has now reached in excess of 70%?
I’m telling you, you can’t stop the spread of a highly contagious respiratory virus. The only way you can do that is isolate remote villages and we just don’t live like that anymore in most parts of the world.
I’m not sure what studies you are referring to. But I don’t think we’ll ever get reliable studies on SARS-CoV-2 spread on a societal scale because we don’t have the data for it. And that data won’t materialise out of nowhere. The data points we are collecting (PCR tests) aren’t organised scientifically, there are no controls set up and they aren’t even comparable across a single country, not to mention several nations or something like that.
So yes, we have a ton of raw data (more than we know what to do with), but it’s of bad quality. Which won’t stop idiots from feeding it into computer models and calling it science, but it won’t give us any dependable results.
The point is avoiding an ICU stay isn’t up to you. That depends on your body. You might get the virus and nothing happens. You might get vaccinated, get the virus, and still end up in the ICU.
Forcing other people into getting vaccinated because you are afraid to end up in the ICU is just not a very ethical thing to do. And it shouldn’t be the policy in an enlightened democracy. Not to mention that it clearly does not work, the situation on the ground is showing that right now.
I don’t understand why people can’t just be happy that there’s a vaccine and take it if they want. And then just live their lives without having to order other people around. If you are so afraid of this thing, stay at home for the next years. That’s totally fair. But let those who want live their damn lives. What do you care if they end up in the ICU?
I don’t understand this mindset many people have, that’s my main problem. If I said two years ago “I wanna climb Mt. Everest” most people would have said “good for you!” even though several people a year die doing that and the death rate is higher than one in a thousand. But if I now say “I don’t want to get vaccinated” the same people would say “are you insane?”
Good, seems that we are getting somewhere This is exactly why I said that in the context of this forum I think there is no real problem with that statement.
But - in the context of people who might hear your podcast episodes (which I hope is a larger audience, and will still grow), I am not at all sure.
If you say such things without explicitly listing some relevant historical facts, people who do not know them (think “not educated in my or your country” - not “stupid”) might naturally think that you imply some particular incorrect “facts”. This would in fact make the net situation worse.
I don’t know. That’s a decision we have to make in societies a lot. It’s the job of politicians to do stuff like this, really. What I was trying to say was there is a huge difference between things like Ebola (almost certain that you’ll die and no “easy” disease progression at all) and SARS-CoV-2 (extremely unlikely that you die, easy disease progression in almost all cases).
To use my previous example: If Ebola is the risk equivalent of climbing Everest, then SARS-CoV-2 is like climbing Ayers Rock. You can die doing both, but one is a lot more likely than the other.
